Skip to main content
Addgene

pGL3-sgRab18.N-Cas9-T2A-mCherry-P2A-Puro
(Plasmid #129418)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129418 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL3-basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 9321
  • Modifications to backbone
    Only plasmid backbone for amplification in E.coli was used.
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin ; mCherry for FACS enrichment

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9 and sgRAB18.N
  • Alt name
    RAB18LI1
  • gRNA/shRNA sequence
    GAACGGGGTCAGGATGGACG agg
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAB18 (a.k.a. RAB18LI1, WARBM3)
  • Promoter hU6
  • Tag / Fusion Protein
    • T2A-mCherry-P2A-Puro (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer gactatcatatgcttaccgt
  • 3′ sequencing primer -
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector was generated by Shiqian Li (Elina Ikonen Lab).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-sgRab18.N-Cas9-T2A-mCherry-P2A-Puro was a gift from Elina Ikonen (Addgene plasmid # 129418 ; http://n2t.net/addgene:129418 ; RRID:Addgene_129418)
  • For your References section:

    Seipin Facilitates Triglyceride Flow to Lipid Droplet and Counteracts Droplet Ripening via Endoplasmic Reticulum Contact. Salo VT, Li S, Vihinen H, Holtta-Vuori M, Szkalisity A, Horvath P, Belevich I, Peranen J, Thiele C, Somerharju P, Zhao H, Santinho A, Thiam AR, Jokitalo E, Ikonen E. Dev Cell. 2019 Jun 6. pii: S1534-5807(19)30388-0. doi: 10.1016/j.devcel.2019.05.016. 10.1016/j.devcel.2019.05.016 PubMed 31178403