pORTMAGE302A
(Plasmid
#128970)
-
PurposeBroad-host-range KanR plasmid expressing PapRecT and EcMutL_E32K with high temperature induction
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepSIM8
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 7135
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePapRecT
-
SpeciesP. aeruginosa
-
Insert Size (bp)747
-
GenBank IDWP_003088368
- Promoter cI-pL
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAGGGCAGCATTCAAAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemutL E32K
-
Alt nameDominant-Negative MutL
-
SpeciesE. coli
-
Insert Size (bp)1848
-
MutationE32K
-
GenBank IDNP_418591
- Promoter cI-pL
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTACAAGACTAAAGGTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORTMAGE302A was a gift from George Church (Addgene plasmid # 128970 ; http://n2t.net/addgene:128970 ; RRID:Addgene_128970)
Map uploaded by the depositor.
