pMJA167
(Plasmid #128536)

• Purpose: Expresses DsRed
• Depositing Lab: Marcos Alcocer
• Publication: Wang et al Mol Biotechnol. 2014 Feb;56(2):136-46. doi: 10.1007/s12033-013-9689-x.

Backbone

• Vector backbone: pUB6/V5-His A
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5175
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NFAT-DsRed reporter
• Alt name: KX591058.1
• Species: Discosoma sp
• Insert Size (bp): 678
• Promoter: SV40-NFAT

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TTTCACCGTCATCACCGAAACG
• 3′ sequencing primer: TGGGGATACCCCCTAGAGCCC

Resource Information

• Supplemental Documents:
  • pMJA167=NFAT+ DsRed (Phil).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Report expression of DsRed in mammalian cells driven by NF-AT