Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pS6-hα2M-H6
(Plasmid #128495)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128495 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV-Sport 6
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4396
  • Total vector size (bp) 8731
  • Modifications to backbone
    Introduction of Igk leader
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    A2M (G27-S1468)
  • Alt name
    CPAMD5
  • Alt name
    FWP007
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4335
  • GenBank ID
    CR749334
  • Entrez Gene
    A2M (a.k.a. A2MD, CPAMD5, FWP007, S863-7)
  • Promoter CMV
  • Tag / Fusion Protein
    • His tag (6x) (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tgggttccaggttccactggtgacggaaaaccgcagtatatggttctg
  • 3′ sequencing primer gctgagtacaatgctccttgcagccaccatcaccatcaccattaggcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pS6-hα2M-H6 was a gift from F Xavier Gomis-Ruth (Addgene plasmid # 128495 ; http://n2t.net/addgene:128495 ; RRID:Addgene_128495)
  • For your References section:

    Recombinant production of human alpha2-macroglobulin variants and interaction studies with recombinant G-related alpha2-macroglobulin binding protein and latent transforming growth factor-beta2. Marino-Puertas L, Del Amo-Maestro L, Taules M, Gomis-Ruth FX, Goulas T. Sci Rep. 2019 Jun 24;9(1):9186. doi: 10.1038/s41598-019-45712-z. 10.1038/s41598-019-45712-z PubMed 31235767