pAAV-Ef1a-fDIO-JRGECO1a
(Plasmid
#128317)
-
PurposeExpresses JRGECO1a under control of eukaryotic Ef1a promoter after Flp-dependent recombination.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV1 | 128317-AAV1 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $405 |
Backbone
-
Vector backbonepAAV-Ef1a-fDIO
-
Backbone manufacturerAddgene # 55641
- Backbone size w/o insert (bp) 6323
- Total vector size (bp) 7025
-
Modifications to backboneEYFP cDNA removed by AscI-NheI double digest
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-JRGECO1a
-
SpeciesSynthetic
-
Insert Size (bp)1431
- Promoter Ef1a
-
Tag
/ Fusion Protein
- His Tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNES-JRGECO1a cDNA was obtained as a NotI-BglII fragment from Addgene #61563. Vector backbone was derived from Addgene # 55641.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for AAV1 (Catalog # 128317-AAV1) ( Back to top)
Purpose
Ready-to-use AAV1 particles produced from pAAV-Ef1a-fDIO-JRGECO1a (#128317). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-JRGECO1a plasmid DNA.
EF1a-driven, Flp-dependent expression of the biosensor jRGECO1a. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using recombinase-dependent vectors in vivo: FRT sites in fDIO plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Flp-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Flp-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Flp-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Flp-independent expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-fDIO-JRGECO1a was a gift from Patricia Jensen (Addgene plasmid # 128317 ; http://n2t.net/addgene:128317 ; RRID:Addgene_128317) For viral preps, please replace (Addgene plasmid # 128317) in the above sentence with: (Addgene viral prep # 128317-AAV1)