pCMV-GABARα1N-HA
(Plasmid
#128110)
-
PurposeExpress GABARα1 N terminal domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 3718
- Total vector size (bp) 4675
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGabra1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)727
-
GenBank IDNM_001359035.1
-
Entrez GeneGabra1 (a.k.a. GABAA-alpha1, GABAAR-alpha1, Gabra-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggacccatgacagtgctccggctaaac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-GABARα1N-HA was a gift from Huda Zoghbi (Addgene plasmid # 128110 ; http://n2t.net/addgene:128110 ; RRID:Addgene_128110) -
For your References section:
Neurexophilin4 is a selectively expressed alpha-neurexin ligand that modulates specific cerebellar synapses and motor functions. Meng X, McGraw CM, Wang W, Jing J, Yeh SY, Wang L, Lopez J, Brown AM, Lin T, Chen W, Xue M, Sillitoe RV, Jiang X, Zoghbi HY. Elife. 2019 Sep 16;8. pii: 46773. doi: 10.7554/eLife.46773. 10.7554/eLife.46773 PubMed 31524598