Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSH69
(Plasmid #127702)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127702 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    prab-3
  • Backbone size w/o insert (bp) 4300
  • Total vector size (bp) 4914
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ssGFP-1/10
  • Species
    Synthetic
  • Insert Size (bp)
    642
  • Promoter rab-3

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer aaaaaagcaggcttaatgttctccgagttacgaatacttcg
  • 3′ sequencing primer CAAGaaagctgggtaTTTTTCATTTGGATCTTTGCTCAGGACTGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH69 was a gift from David M. Miller (Addgene plasmid # 127702 ; http://n2t.net/addgene:127702 ; RRID:Addgene_127702)
  • For your References section:

    NATF (Native And Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans. He S, Cuentas-Condori A, Miller DM. Genetics. 2019 Apr 5. pii: genetics.119.302063. doi: 10.1534/genetics.119.302063. 10.1534/genetics.119.302063 PubMed 30952669