CA-Stat3-t2A-mCherry
(Plasmid #127540)

• Purpose: Expresses constitutively active (CA) mouse Stat3 and mCherry via t2A linker.
• Depositing Lab: Jennifer Mitchell
• Publication: Dhaliwal et al Genes Dev. 2019 Jun 20. pii: gad.324319.119. doi: 10.1101/gad.324319.119.

Backbone

• Vector backbone: pcDNA3.3-TOPO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 6150
• Total vector size (bp): 8460
• Modifications to backbone: Inserted T2a-mCherry at 3' terminal of MCS.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Stat3
• Alt name: Aprf
• Species: M. musculus (mouse)
• Insert Size (bp): 2310
• Mutation: A662C and N664C. Residues changed to Cys renders the molecule constitutively active.
• GenBank ID: NM_213659
• Entrez Gene: Stat3 (a.k.a. 1110034C02Rik, Aprf)
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TTGGTCACCTTCAGCTTGG

Resource Information

• Supplemental Documents:
  • CA-stat3-t2a-mcherry.gb
• A portion of this plasmid was derived from a plasmid made by: Stat3 was subcloned from Addgene plasmid #8722
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A662C and N664C. Residues changed to Cys renders the molecule constitutively active (Addgene #8722).