pR26-mBMP7
(Plasmid #127374)

• Purpose: Allows for doxycycline-inducible BMP7 expression from the murine ROSA26 safe harbor locus upon CRISPR/Cas9-mediated genomic insertion and stable selection.
• Depositing Lab: Lance Miller
• Publication: Routh et al Front Immunol. 2020 Feb 13;11:57. doi: 10.3389/fimmu.2020.00057. eCollection 2020.

Backbone

• Vector backbone: pCR-Blunt II-TOPO
• Backbone manufacturer: Invitrogen (Life Technologies)
• Backbone size w/o insert (bp): 9987
• Total vector size (bp): 11242
• Modifications to backbone: Inserted left and right ROSA26 homology arms, adenoviral splice acceptor, MCS, and DNA sequence encoding machinery facilitating doxycycline inducible gene expression (tight TRE promoter, rtTA-advanced), as well as PuroR resistance gene for stable selection.
• Vector type: Mouse Targeting, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BMP7
• Alt name: OP-1
• Species: M. musculus (mouse)
• Entrez Gene: Bmp7 (a.k.a. OP1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: ACGTATGTCGAGGTAGGCG
• 3′ sequencing primer: GAGAGTGAAGCAGAACGTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry