Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AbVec2.0-mIghg2b
(Plasmid #127155)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127155 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 5729
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ighg2b
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1008
  • GenBank ID
    LR588430
  • Entrez Gene
    Ighg2b (a.k.a. IgG2b, Igh-3, gamma2b)
  • Promoter hCMV IE1 gene promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BclI (destroyed during cloning)
  • 5′ sequencing primer GCTTCGTTAGAACGCGGCTAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AbVec2.0-mIghg2b was a gift from Hedda Wardemann (Addgene plasmid # 127155 ; http://n2t.net/addgene:127155 ; RRID:Addgene_127155)
  • For your References section:

    ALDH4A1 is an atherosclerosis auto-antigen targeted by protective antibodies. Lorenzo C, Delgado P, Busse CE, Sanz-Bravo A, Martos-Folgado I, Bonzon-Kulichenko E, Ferrarini A, Gonzalez-Valdes IB, Mur SM, Roldan-Montero R, Martinez-Lopez D, Martin-Ventura JL, Vazquez J, Wardemann H, Ramiro AR. Nature. 2021 Jan;589(7841):287-292. doi: 10.1038/s41586-020-2993-2. Epub 2020 Dec 2. 10.1038/s41586-020-2993-2 PubMed 33268892