AbVec2.0-mIghg3
(Plasmid
#127160)
-
PurposeExpression of secretory immunoglobulin heavy chains in mammalian cells, mouse (C57BL/6), IgG3 isotype
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 5729
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIghg3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)990
-
GenBank IDLR588432
-
Entrez GeneIghg3 (a.k.a. IgG3)
- Promoter hCMV IE1 gene promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BclI (destroyed during cloning)
- 5′ sequencing primer GCTTCGTTAGAACGCGGCTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AbVec2.0-mIghg3 was a gift from Hedda Wardemann (Addgene plasmid # 127160 ; http://n2t.net/addgene:127160 ; RRID:Addgene_127160)