(SIM)10
(Plasmid
#126946)
-
PurposeBacterial expression plasmid for (SIM)10 client to assess SUMO-SIM scaffolds.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
-
Backbone manufacturerunknown
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7056
-
Modifications to backboneHis10-MBP-tev-cloning sites-tev-RK see attachment
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name10 repeats of SUMO interacting motif (SIM) from PIASx each separated by (GGS)4
-
Alt namepoly-SIM
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1056
-
Entrez GenePIAS2 (a.k.a. ARIP3, DIP, MIZ1, PIASX, SIZ2, ZMIZ4)
- Promoter unknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
(SIM)10 was a gift from Michael Rosen (Addgene plasmid # 126946 ; http://n2t.net/addgene:126946 ; RRID:Addgene_126946) -
For your References section:
Compositional Control of Phase-Separated Cellular Bodies. Banani SF, Rice AM, Peeples WB, Lin Y, Jain S, Parker R, Rosen MK. Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30. 10.1016/j.cell.2016.06.010 PubMed 27374333