(SUMO)5-(SIM)10
(Plasmid #126923)

• Purpose: Bacterial expression plasmid for multivalent scaffold of (SUMO)5-(SIM)10 biomolecular condensates to recruit SUMO-containing client proteins.
• Depositing Lab: Michael Rosen
• Publication: Banani et al Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30.

Backbone

• Vector backbone: pMal-tev
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 6600
• Total vector size (bp): 9225
• Modifications to backbone: tev sites added on either side of the NdeI / BamHI cloning site C-terminal His6 added, HindIII site added after C-terminal His6
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 5 repeats of human SUMO3 and 10 repeats of human SUMO interactive motif (SIM) from PIASx each separated by (GGS)4
• Species: H. sapiens (human)
• Insert Size (bp): 2625
• Mutation: internal BamHI site between (SUMO)5 and (SIM)10
• Entrez Gene: SUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
• Promoter: tac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHi and BglII (destroyed during cloning)
• 5′ sequencing primer: TGCGTACTGCGGTGATCAAC'
• 3′ sequencing primer: GTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pMTTH
  • expression and purification protocol

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry