pRSFDuet1-Cdc45
(Plasmid
#126878)
-
PurposeExpresses human Cdc45 in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSFDuet1
- Backbone size w/o insert (bp) 3829
- Total vector size (bp) 5476
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDC45
-
Alt nameCell Division Cycle 45
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1723
-
Entrez GeneCDC45 (a.k.a. CDC45L, CDC45L2, MGORS7, PORC-PI-1)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- No tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet1-Cdc45 was a gift from Luca Pellegrini (Addgene plasmid # 126878 ; http://n2t.net/addgene:126878 ; RRID:Addgene_126878) -
For your References section:
Structure of human Cdc45 and implications for CMG helicase function. Simon AC, Sannino V, Costanzo V, Pellegrini L. Nat Commun. 2016 May 18;7:11638. doi: 10.1038/ncomms11638. 10.1038/ncomms11638 PubMed 27189187