Skip to main content
Addgene

(SUMO)10-(SIM)5
(Plasmid #126866)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126866 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMal-tev
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 10368
  • Modifications to backbone
    tev sites added on either side of the NdeI / BamHI cloning site C-terminal His6 added
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    10 repeats of human SUMO3 and 5 repeats of human SUMO interactive motif (SIM) from PIASx each separated by (GGS)4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3660
  • Entrez Gene
    SUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
  • Promoter tac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TGCGTACTGCGGTGATCAAC
  • 3′ sequencing primer GTAAAACGACGGCCAGT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    (SUMO)10-(SIM)5 was a gift from Michael Rosen (Addgene plasmid # 126866 ; http://n2t.net/addgene:126866 ; RRID:Addgene_126866)

  • For your References section:

    Compositional Control of Phase-Separated Cellular Bodies. Banani SF, Rice AM, Peeples WB, Lin Y, Jain S, Parker R, Rosen MK. Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30. 10.1016/j.cell.2016.06.010 PubMed 27374333
Related items:
Commonly requested with: