Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHAGE-EF1aL-TagBFP-W
(Plasmid #126687)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126687 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHAGE
  • Backbone manufacturer
    Derived in Kotton lab
  • Backbone size w/o insert (bp) 6978
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagBFP
  • Species
    Synthetic
  • Insert Size (bp)
    702
  • Promoter Ef1aL

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ggttcattctcaagcctcagacagtg
  • 3′ sequencing primer gctattgcttcccgtatggctttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-EF1aL-TagBFP-W was a gift from Darrell Kotton (Addgene plasmid # 126687 ; http://n2t.net/addgene:126687 ; RRID:Addgene_126687)
  • For your References section:

    Derivation of self-renewing lung alveolar epithelial type II cells from human pluripotent stem cells. Jacob A, Vedaie M, Roberts DA, Thomas DC, Villacorta-Martin C, Alysandratos KD, Hawkins F, Kotton DN. Nat Protoc. 2019 Dec;14(12):3303-3332. doi: 10.1038/s41596-019-0220-0. Epub 2019 Nov 15. 10.1038/s41596-019-0220-0 PubMed 31732721