NLS-HA-2xMCP-KRAB
(Plasmid
#126589)
-
PurposeExpresses MCP (MS2 Coat Protein) fusion to KRAB in mammalian cells, lentiviral backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE-UbiC
- Total vector size (bp) 7274
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name2XMCP-KRAB
-
Alt name2x MS2 coat protein
-
Alt nameKRAB; KOX1 (aa14-85)
-
SpeciesSynthetic
- Promoter human ubiquitin C promoter
-
Tag
/ Fusion Protein
- NLS-HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
- 3′ sequencing primer mTagBFP-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NLS-HA-2xMCP-KRAB was a gift from David Segal (Addgene plasmid # 126589 ; http://n2t.net/addgene:126589 ; RRID:Addgene_126589) -
For your References section:
Ezh2-dCas9 and KRAB-dCas9 enable engineering of epigenetic memory in a context-dependent manner. O'Geen H, Bates SL, Carter SS, Nisson KA, Halmai J, Fink KD, Rhie SK, Farnham PJ, Segal DJ. Epigenetics Chromatin. 2019 May 3;12(1):26. doi: 10.1186/s13072-019-0275-8. 10.1186/s13072-019-0275-8 PubMed 31053162