pSELt_S7.A
(Plasmid
#125835)
-
PurposeNegative selection plasmid for evolution of an amber stop codon suppression tRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backboneCustom Backbone
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameACP-2xAmb-pheS
-
Alt nameacyl carrier protein fused to pheS with two amber stop codons in the linker sequence
-
SpeciesE. coli
-
Insert Size (bp)1239
-
GenBank IDWP_001637778.1 EGT68318.1
- Promoter pr.trpL*
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACTTCGCAGAATAAATAAATCCTGGTGTCC
- 3′ sequencing primer GCGTTAAATTTTTGTTAAATCAGCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSELt_S7.A was a gift from Andrew Ellington (Addgene plasmid # 125835 ; http://n2t.net/addgene:125835 ; RRID:Addgene_125835) -
For your References section:
Evolving Orthogonal Suppressor tRNAs To Incorporate Modified Amino Acids. Maranhao AC, Ellington AD. ACS Synth Biol. 2017 Jan 20;6(1):108-119. doi: 10.1021/acssynbio.6b00145. Epub 2016 Sep 21. 10.1021/acssynbio.6b00145 PubMed 27600875