pSBbi-Puro_LPAR_AKAR-mut
(Plasmid #125207)

• Purpose: SB-transposon plasmid for stable expression of unphosphorylatable "dead" version of lipid raft-targeted FRET-based PKA activity reporter
• Depositing Lab: Eric Davis
• Publication: Eric Davis SB transposon plasmids (unpublished)

Backbone

• Vector backbone: pSBbi-Pur
• Backbone manufacturer: Addgene plasmid # 60523
• Backbone size w/o insert (bp): 5661
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LPAR_AKAR-mut
• Species: Synthetic
• Insert Size (bp): 2388
• Mutation: FoxO1 Thr-24 changed to Val rendering this inactive and unphosphorylatable
• Promoter: EF1a/RPBSA
• Tags / Fusion Proteins:
  • Lyn tag (GCIKSKRKD), mCerulean3 (N terminal on insert)
  • EV linker, cpVenus[E172] (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: GCCTCAGACAGTGGTTCAAAG
• 3′ sequencing primer: AGGCACAGTCGAGGCTGAT

Resource Information

• Supplemental Documents:
  • Annotated sequences of AKT activity FRET reporter and control plasmids

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert subcloned from Addgene plasmid #64932. Targeted to membrane by lipid raft-targeting peptide (GCIKSKRKD) derived from human kinase LYN.