Skip to main content
Addgene

pAAV-EF1a-FDIO-ArchT-GFP
(Plasmid #124640)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124640 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV
  • Backbone manufacturer
    Karl Deisseroth (EF1a-fDIO-hChr2(H134R)-EYFP, Addgene 55639)
  • Backbone size w/o insert (bp) 5603
  • Total vector size (bp) 7079
  • Vector type
    Mammalian Expression, AAV ; Flp/Frt

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ArchT
  • Alt name
    archaerhodopsin TP009
  • Species
    Halorubrum sp. TP009
  • Insert Size (bp)
    1476
  • GenBank ID
    HM367071.1
  • Promoter EF1a
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-FDIO-ArchT-GFP was a gift from David Dupret (Addgene plasmid # 124640 ; http://n2t.net/addgene:124640 ; RRID:Addgene_124640)

  • For your References section:

    A Hippocampus-Accumbens Tripartite Neuronal Motif Guides Appetitive Memory in Space. Trouche S, Koren V, Doig NM, Ellender TJ, El-Gaby M, Lopes-Dos-Santos V, Reeve HM, Perestenko PV, Garas FN, Magill PJ, Sharott A, Dupret D. Cell. 2019 Mar 7;176(6):1393-1406.e16. doi: 10.1016/j.cell.2018.12.037. Epub 2019 Feb 14. 10.1016/j.cell.2018.12.037 PubMed 30773318
Related items:
Commonly requested with: