GluR2_adRNA(1,20,6)-ADAR2
(Plasmid #124620)

• Purpose: Expresses adRNA (1,20,6) targeting the RAB7A transcript along with the ADAR2
• Depositing Lab: Prashant Mali
• Publication: Katrekar et al Nat Methods. 2019 Mar;16(3):239-242. doi: 10.1038/s41592-019-0323-0. Epub 2019 Feb 8.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: Unknown
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ADAR2
• Species: H. sapiens (human)
• Insert Size (bp): 2106
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: TCCTTCCGTGTTTCAGTTAGCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Also expresses 2 copies of GluR2_adRNA(1,20,6) from human and mouse U6 promoters