Col7A1-CRISPR-gRNA#exon2-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
(Plasmid #124286)

• Purpose: sgRNA against human Col7A1
• Depositing Labs: Katalin Josvay, Csaba Vizler
• Publication: Vizler lab CRISPR plasmids (unpublished)

Backbone

• Vector backbone: pSpCas9(BB)-2A-Puro (PX459) V2.0
• Backbone manufacturer: Feng Zhang (Addgene plasmid # 62988)
• Backbone size w/o insert (bp): 9200
• Vector type: CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Collagen type VII alpha 1 chain
• Alt name: COL7A1
• gRNA/shRNA sequence: (g)AGCGGCGTAAAGGCGCGTGC
• Species: H. sapiens (human)
• Insert Size (bp): 21
• Entrez Gene: COL7A1 (a.k.a. EBD1, EBDCT, EBR1, NDNC8)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: U6-fw: GGGCCTATTTCCCATGATTCCTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plus "G" was routinely added because U6 promoter prefers "G" as the first transcribed nucleotide. gRNA sequence contains at least 3 mismatches, and was selected by choosing the highest scored sequence from different programs and databases.