pAAV-Syn-FLEX-rc [ArchT-tdTomato]
(Plasmid #123607)

• Purpose: AAV mediated expression of ArchT-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. tdTomato has codons varied to reduce recombination. Using bGHpA signal.
• Depositing Lab: Edward Boyden
• Publication: Han et al Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV-Syn-FLEX
• Backbone manufacturer: Scott Sternson lab
• Backbone size w/o insert (bp): 4763
• Total vector size (bp): 6860
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ArchT-tdTomato
• Alt name: ArchaerhodopsinT-tdTomato
• Alt name: Archaerhodopsin TP009-tdTomato
• Species: Synthetic; H. strain TP009
• Insert Size (bp): 2187
• GenBank ID: HM367071.1
• Promoter: Syn
• Tag / Fusion Protein:
  • tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: gcacgggcgcgaccatctgc
• 3′ sequencing primer: TAGCGTAAAAGGAGCAACATAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.