CDH5-AbR-GFP
(Plasmid #122970)

• Purpose: Lenti plasmid containing a CDH5 promoter driving GFP followed by T2A and an antibiotic resistance cassette (zeocin). Used for selection of endothelial cells.
• Depositing Lab: Budd A. Tucker
• Publication: CDH5-GFP-AB (unpublished)

Backbone

• Vector backbone: pLenti6⁄V5-DEST™ Gateway® Vector
• Backbone manufacturer: ThermoFisher Scientific
• Total vector size (bp): 10066
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CDH5p
• Alt name: CDH5 promoter
• Species: H. sapiens (human)
• Insert Size (bp): 1500
• Mutation: NA

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TTCAGACCTGGAGGAGGAGATA
• 3′ sequencing primer: AGATCAGCGGCCGCTTGCTG

Gene/Insert 2

• Gene/Insert name: CopGFP
• Alt name: green fluorescent protein cloned from copepod
• Species: Copepod
• Insert Size (bp): 650

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TTCAGACCTGGAGGAGGAGATA
• 3′ sequencing primer: AGATCAGCGGCCGCTTGCTG

Gene/Insert 3

• Gene/Insert name: Zeocin
• Species: Antibiotic Resistance Cassette
• Insert Size (bp): 400
• Mutation: NA

Cloning Information for Gene/Insert 3

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TTCAGACCTGGAGGAGGAGATA
• 3′ sequencing primer: AGATCAGCGGCCGCTTGCTG

Resource Information

• Supplemental Documents:
  • pLenti6,4-CDH5p-GreenZeo-R4R2-V5-DEST.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry