pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-mCherry
(Plasmid #122959)

• Purpose: Lentiviral expression of NOTCH2NL delta C terminus under CAG promoter with mCherry expression
• Depositing Lab: Pierre Vanderhaeghen
• Publication: Suzuki et al Cell. 2018 May 31;173(6):1370-1384.e16. doi: 10.1016/j.cell.2018.03.067. Epub 2018 May 31.

Backbone

• Vector backbone: lentiviral
• Backbone manufacturer: Dr. Cecile Charrier
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3 is also recommended.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NOTCH2NL-delta C terminus
• Alt name: N2NL-delta Cter
• Species: H. sapiens (human)
• Insert Size (bp): 1047
• Mutation: deletion of C terminus from full length NOTCH2NLB
• Entrez Gene: NOTCH2NLB (a.k.a. N2N, NOTCH2NL, NOTCH2NLA)
• Promoter: CAG promoter
• Tag / Fusion Protein:
  • 6xmyc tag (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTACAGCTCCTGGGCAACGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry