pACT1:Cas9-GFP, U6:sgUPRT
(Plasmid
#122853)
-
PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum UPRT gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 2700
- Total vector size (bp) 9981
-
Vector typeCRISPR ; Cas9-GFP plasmid for genome editing of Cryptosporidium parasites
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9-GFP
-
Speciesstreptococcus pyogenes
-
Insert Size (bp)4956
- Promoter Cryptosporidium parvum actin
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCAACACTTAACCTTTCAGT
- 3′ sequencing primer TCAGTTCTATTCTCATTTGAAAGCT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameU6-sgUPRT
-
SpeciesCryptosporidium parvum
-
Insert Size (bp)716
- Promoter Cryptosporidium parvum U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGCGCCAAGACCCAG
- 3′ sequencing primer CTATAGTGTCACCTAAATAGCTTGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACT1:Cas9-GFP, U6:sgUPRT was a gift from David Sibley (Addgene plasmid # 122853 ; http://n2t.net/addgene:122853 ; RRID:Addgene_122853) -
For your References section:
A Stem-Cell-Derived Platform Enables Complete Cryptosporidium Development In Vitro and Genetic Tractability. Wilke G, Funkhouser-Jones LJ, Wang Y, Ravindran S, Wang Q, Beatty WL, Baldridge MT, VanDussen KL, Shen B, Kuhlenschmidt MS, Kuhlenschmidt TB, Witola WH, Stappenbeck TS, Sibley LD. Cell Host Microbe. 2019 Jun 18. pii: S1931-3128(19)30252-5. doi: 10.1016/j.chom.2019.05.007. 10.1016/j.chom.2019.05.007 PubMed 31231046