pAAV-EF1α1.1-GFP
(Plasmid #122100)

• Purpose: AAV-mediated expression of GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.
• Depositing Lab: Edward Boyden
• Publication: Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9.

Backbone

• Vector backbone: pAAV-EF1α1.1
• Backbone manufacturer: Scott Sternson lab
• Backbone size w/o insert (bp): 4974
• Total vector size (bp): 5694
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP
• Alt name: EGFP
• Alt name: Enhanced Green Fluorescent Protein
• Species: Synthetic
• Insert Size (bp): 720
• GenBank ID:
• Promoter: EF1a（1.1kb short version)
• Tag / Fusion Protein:
  • NA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ggatcttggttcattctcaag
• 3′ sequencing primer: aaagagacagcaaccagg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (fluorophore region). Multiple digestions were done to verify the vector structure. The construct was tested in vitro.