pCMV6M-Pak1 K299R
(Plasmid #12210)

• Depositing Lab: Jonathan Chernoff
• Publication: Sells et al Curr Biol. 1997 Mar 1. 7(3):202-10.

Backbone

• Vector backbone: pCMV6
• Backbone size w/o insert (bp): 4900
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pak1
• Species: H. sapiens (human)
• Insert Size (bp): 2000
• Mutation: Catalytically inactive Pak1: K299R
• Entrez Gene: PAK1 (a.k.a. IDDMSSD, PAKalpha, alpha-PAK, p65-PAK)
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTCGTTTAGTGAACCGTCAG
• 3′ sequencing primer: GGAACTTCCAAGGCCAGGA

Resource Information

• Articles Citing this Plasmid:
  • 10 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the reference sequence from the depositor does not have the K299R mutation. Addgene has sequenced this plasmid and verified this mutation.

There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way.

Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function.