pAAV-EF1α1.1-Chronos-tdTomato
(Plasmid #122099)

• Purpose: AAV-mediated expression of Chronos-tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.
• Depositing Lab: Edward Boyden
• Publication: Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9.

Backbone

• Vector backbone: pAAV-EF1α1.1
• Backbone manufacturer: Scott Sternson lab
• Backbone size w/o insert (bp): 4974
• Total vector size (bp): 7395
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Chronos-tdTomato
• Alt name: Stigeoclonium helveticum channelrhodopsin-tdTomato
• Alt name: ChR90-tdTomato
• Species: Synthetic; Stigeoclonium helveticum
• Insert Size (bp): 2421
• GenBank ID: KF992040
• Promoter: EF1α (1.1 kb short version)
• Tag / Fusion Protein:
  • tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ggatcttggttcattctcaag
• 3′ sequencing primer: aaagagacagcaaccagg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct was tested in vitro.