Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRRLSIN.cPPT.PGK.MyoD.WPRE
(Plasmid #122053)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122053 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRLSIN.cPPT.PGK.WPRE
  • Backbone size w/o insert (bp) 6667
  • Total vector size (bp) 8475
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MyoD
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    957
  • GenBank ID
    NM_010866.2
  • Entrez Gene
    Myod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGTCGGCTCCCTCGTTGACC
  • 3′ sequencing primer CAGCGTATCCACATAGCGTAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRLSIN.cPPT.PGK.MyoD.WPRE was a gift from Stephen Tapscott (Addgene plasmid # 122053 ; http://n2t.net/addgene:122053 ; RRID:Addgene_122053)
  • For your References section:

    Conversion of MyoD to a neurogenic factor: binding site specificity determines lineage. Fong AP, Yao Z, Zhong JW, Johnson NM, Farr GH 3rd, Maves L, Tapscott SJ. Cell Rep. 2015 Mar 31;10(12):1937-46. doi: 10.1016/j.celrep.2015.02.055. Epub 2015 Mar 19. 10.1016/j.celrep.2015.02.055 PubMed 25801030