pAH235
(Plasmid #121145)

• Purpose: Cas9 expression controlled by the nmt41 promoter
• Depositing Lab: Katsunori Tanaka
• Publication: Hayashi et al G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976.

Backbone

• Vector backbone: pSLF273
• Backbone size w/o insert (bp): 8460
• Total vector size (bp): 12736
• Vector type: Yeast Expression, CRISPR
• Selectable markers: S.pombe ura4

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanized Streptococcus pyogenes Cas9
• Species: Synthetic
• Insert Size (bp): 4276
• Promoter: nmt41
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (destroyed during cloning)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: TCTCACTTTCTGACTTATAGTCGCT
• 3′ sequencing primer: AGCAGTACTGGCAAGGGAGAC

Resource Information

• Supplemental Documents:
  • pAH235n

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Ran, F.A., Hsu, P.D.P., Wright, J., Agarwala, V., Scott, D. a and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281–2308. After prepping the DNA, it is recommended to heat the DNA to 65C before digesting with Bbs I. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.