-
PurposeExpresses the M495V/Y515N/K526E/R661Q (evoCas9) SpCas9 variant in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX330 (Addgene #42230)
- Total vector size (bp) 8090
-
Modifications to backboneRemoved sgRNA expression cassette.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHumanized S. pyogenes Cas9
-
Alt namehSpCas9
-
Insert Size (bp)4272
-
MutationM495V/Y515N/K526E/R661Q
- Promoter CBh
-
Tag
/ Fusion Protein
- 3XFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypX-evoCas9 was obtained through modifications of the PX330 backbone (Addgene #42230)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX-evoCas9 was a gift from Anna Cereseto (Addgene plasmid # 107550 ; http://n2t.net/addgene:107550 ; RRID:Addgene_107550) -
For your References section:
A highly specific SpCas9 variant is identified by in vivo screening in yeast. Casini A, Olivieri M, Petris G, Montagna C, Reginato G, Maule G, Lorenzin F, Prandi D, Romanel A, Demichelis F, Inga A, Cereseto A. Nat Biotechnol. 2018 Jan 29. pii: nbt.4066. doi: 10.1038/nbt.4066. 10.1038/nbt.4066 PubMed 29431739