Skip to main content
Addgene

pX-evoCas9
(Plasmid #107550)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107550 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PX330 (Addgene #42230)
  • Total vector size (bp) 8090
  • Modifications to backbone
    Removed sgRNA expression cassette.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Humanized S. pyogenes Cas9
  • Alt name
    hSpCas9
  • Insert Size (bp)
    4272
  • Mutation
    M495V/Y515N/K526E/R661Q
  • Promoter CBh
  • Tag / Fusion Protein
    • 3XFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pX-evoCas9 was obtained through modifications of the PX330 backbone (Addgene #42230)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX-evoCas9 was a gift from Anna Cereseto (Addgene plasmid # 107550 ; http://n2t.net/addgene:107550 ; RRID:Addgene_107550)
  • For your References section:

    A highly specific SpCas9 variant is identified by in vivo screening in yeast. Casini A, Olivieri M, Petris G, Montagna C, Reginato G, Maule G, Lorenzin F, Prandi D, Romanel A, Demichelis F, Inga A, Cereseto A. Nat Biotechnol. 2018 Jan 29. pii: nbt.4066. doi: 10.1038/nbt.4066. 10.1038/nbt.4066 PubMed 29431739