Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAH233
(Plasmid #121144)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121144 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pREP1
  • Backbone size w/o insert (bp) 6556
  • Total vector size (bp) 8996
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA cassette
  • gRNA/shRNA sequence
    CACCGGGTCTTCGAGAAGACCTGTtttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaaagtgagtggcaccgagtcggtggtgc
  • Species
    S. pombe (fission yeast)
  • Promoter S.pombe rrk1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pst I (destroyed during cloning)
  • 3′ cloning site SacI (destroyed during cloning)
  • 5′ sequencing primer CACACATGAACAAGGAAGTACAGG
  • 3′ sequencing primer AGATAAGTCACTATGTCCGAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Jacobs, J.Z., Ciccaglione, K.M., Tournier, V. and Zaratiegui, M. (2014) Implementation of the CRISPR-Cas9 system in fission yeast. Nat. Commun., 5, 5344. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAH233 was a gift from Katsunori Tanaka (Addgene plasmid # 121144 ; http://n2t.net/addgene:121144 ; RRID:Addgene_121144)
  • For your References section:

    Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast. Hayashi A, Tanaka K. G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976. 10.1534/g3.118.200976 PubMed 30755408