pAH233
(Plasmid
#121144)
-
PurposeExpression of gRNA with BbsI placeholder for target cloning
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 121144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepREP1
- Backbone size w/o insert (bp) 6556
- Total vector size (bp) 8996
-
Vector typeYeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA cassette
-
gRNA/shRNA sequenceCACCGGGTCTTCGAGAAGACCTGTtttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaaagtgagtggcaccgagtcggtggtgc
-
SpeciesS. pombe (fission yeast)
- Promoter S.pombe rrk1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Pst I (destroyed during cloning)
- 3′ cloning site SacI (destroyed during cloning)
- 5′ sequencing primer CACACATGAACAAGGAAGTACAGG
- 3′ sequencing primer AGATAAGTCACTATGTCCGAGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Jacobs, J.Z., Ciccaglione, K.M., Tournier, V. and Zaratiegui, M. (2014) Implementation of the CRISPR-Cas9 system in fission yeast. Nat. Commun., 5, 5344. Supplementary data is available at Figshare: https://doi.org/10.25387/g3.7685642.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAH233 was a gift from Katsunori Tanaka (Addgene plasmid # 121144 ; http://n2t.net/addgene:121144 ; RRID:Addgene_121144) -
For your References section:
Short-Homology-Mediated CRISPR/Cas9-Based Method for Genome Editing in Fission Yeast. Hayashi A, Tanaka K. G3 (Bethesda). 2019 Feb 12. pii: g3.118.200976. doi: 10.1534/g3.118.200976. 10.1534/g3.118.200976 PubMed 30755408