Skip to main content
Addgene

PB-TAC-OK+9MS-Cas9
(Plasmid #120354)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120354 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PB-TAC-Cas9
  • Vector type
    Mammalian Expression, CRISPR ; piggyBac transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OK+9MS cassette
  • Species
    M. musculus (mouse)
  • Mutation
    Klf4 [1-483]

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer ATTGCATCGCATTGTCTGAG
  • 3′ sequencing primer ATGGGGAGAGTGAAGCAGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-TAC-OK+9MS-Cas9 was a gift from Knut Woltjen (Addgene plasmid # 120354 ; http://n2t.net/addgene:120354 ; RRID:Addgene_120354)
  • For your References section:

    OVOL1 Influences the Determination and Expansion of iPSC Reprogramming Intermediates. Kagawa H, Shimamoto R, Kim SI, Oceguera-Yanez F, Yamamoto T, Schroeder T, Woltjen K. Stem Cell Reports. 2018 Dec 28. pii: S2213-6711(18)30527-7. doi: 10.1016/j.stemcr.2018.12.008. 10.1016/j.stemcr.2018.12.008 PubMed 30639212