Skip to main content
Addgene

GAG-CRErec
(Plasmid #119971)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119971 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3-like
  • Total vector size (bp) 7530
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GAG-nlsCRErec
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    2691
  • Promoter hCMV
  • Tag / Fusion Protein
    • nls

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Kpn I (not destroyed)
  • 5′ sequencing primer ACTACATCCTGGTCATCATCC
  • 3′ sequencing primer CCACCTTCTGATAGGCAGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/10/12/202010 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GAG-CRErec was a gift from Philippe Mangeot & Théophile Ohlmann & Emiliano Ricci (Addgene plasmid # 119971 ; http://n2t.net/addgene:119971 ; RRID:Addgene_119971)
  • For your References section:

    Genome editing in primary cells and in vivo using viral-derived Nanoblades loaded with Cas9-sgRNA ribonucleoproteins. Mangeot PE, Risson V, Fusil F, Marnef A, Laurent E, Blin J, Mournetas V, Massourides E, Sohier TJM, Corbin A, Aube F, Teixeira M, Pinset C, Schaeffer L, Legube G, Cosset FL, Verhoeyen E, Ohlmann T, Ricci EP. Nat Commun. 2019 Jan 3;10(1):45. doi: 10.1038/s41467-018-07845-z. 10.1038/s41467-018-07845-z PubMed 30604748