-
Purposeencodes a GAG (F-MLV)-CAS9(sp) fusion. Allows the production of GAG-CAS9 Virus like particles from producer cells in association with over expressed gRNA(s) and appropriate envelopes.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119942 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDNA3-like
- Total vector size (bp) 10745
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAG FMLV fused to spCAS9
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)5877
- Promoter hCMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site BamHI. Not unique after cloning (not destroyed)
- 5′ sequencing primer ACTACATCCTGGTCATCATCC
- 3′ sequencing primer CCACCTTCTGATAGGCAGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCAS9 was amplified from the lentiCRISPR plasmid (addgene #49535) from Zhang lab
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2017/10/12/202010 for BioRxiv preprint. Note, there are some additional amino acids on the 3' end of the insert--depositor confirmed this is the version used in the paper and the plasmid should function as described.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BIC-Gag-CAS9 was a gift from Philippe Mangeot & Théophile Ohlmann & Emiliano Ricci (Addgene plasmid # 119942 ; http://n2t.net/addgene:119942 ; RRID:Addgene_119942) -
For your References section:
Genome editing in primary cells and in vivo using viral-derived Nanoblades loaded with Cas9-sgRNA ribonucleoproteins. Mangeot PE, Risson V, Fusil F, Marnef A, Laurent E, Blin J, Mournetas V, Massourides E, Sohier TJM, Corbin A, Aube F, Teixeira M, Pinset C, Schaeffer L, Legube G, Cosset FL, Verhoeyen E, Ohlmann T, Ricci EP. Nat Commun. 2019 Jan 3;10(1):45. doi: 10.1038/s41467-018-07845-z. 10.1038/s41467-018-07845-z PubMed 30604748