Addgene: pGEX-6p1-GST-ArcΔCTD Skip to main content
Addgene

pGEX-6p1-GST-ArcΔCTD
(Plasmid #119878)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119878 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-6p1
  • Backbone size w/o insert (bp) 4927
  • Total vector size (bp) 5878
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    use BL21 for protein production
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Activity Regulated Cytoskeletal Protein
  • Alt name
    Arc, Arg3.1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    951
  • Mutation
    Deletion of nt 832-1110
  • GenBank ID
    Z46925.1
  • Entrez Gene
    Arc (a.k.a. rg3.1)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TTTGCAGGGCTGGCAAGCCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-6p1-GST-ArcΔCTD was a gift from Jason Shepherd (Addgene plasmid # 119878 ; http://n2t.net/addgene:119878 ; RRID:Addgene_119878)
  • For your References section:

    The Neuronal Gene Arc Encodes a Repurposed Retrotransposon Gag Protein that Mediates Intercellular RNA Transfer. Pastuzyn ED, Day CE, Kearns RB, Kyrke-Smith M, Taibi AV, McCormick J, Yoder N, Belnap DM, Erlendsson S, Morado DR, Briggs JAG, Feschotte C, Shepherd JD. Cell. 2018 Mar 22;173(1):275. doi: 10.1016/j.cell.2018.03.024. 10.1016/j.cell.2018.03.024 PubMed 29570995