pSP2-96-merTetO-EFS-BLaR
(Plasmid #118713)

• Purpose: Contains an optimized 96-mer TetO repeat for imaging of desired loci
• Depositing Lab: Huimin Zhao
• Publication: Tasan et al Nucleic Acids Res. 2018 Jun 15. pii: 5038283. doi: 10.1093/nar/gky501.

Backbone

• Vector backbone: pSP2
• Total vector size (bp): 8485
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Blasticidin resistance gene
• Insert Size (bp): 880

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BstBI (not destroyed)
• 5′ sequencing primer: ATATACTAGGGAGATGAATTTCC
• 3′ sequencing primer: CTTAAGCTAGCAGCGCTCTCG

Gene/Insert 2

• Gene/Insert name: EFS-NS promoter
• Insert Size (bp): 278
• Promoter: EFS-NS

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ATATACTAGGGAGATGAATTTCC

Resource Information

• Supplemental Documents:
  • 96mer EFS-blaR-EFS-hsvTK.gbk
• A portion of this plasmid was derived from a plasmid made by: 96-mer TetO sequence was cloned by Gabriela Sustackova (laboratory of Prof. Andrew Belmont)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry