pAAV-DYRK3-2A-mCherry
(Plasmid #118287)

• Purpose: Expresses mouse DYRK3 tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.
• Depositing Lab: Vance Lemmon
• Publication: Slepak et al Cytoskeleton (Hoboken). 2012 Jul;69(7):514-27. doi: 10.1002/cm.21021. Epub 2012 Mar 7.

Backbone

• Vector backbone: pAAV-2A-mCherry
• Backbone size w/o insert (bp): 5410
• Total vector size (bp): 7168
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3
• Alt name: DYRK3
• Species: M. musculus (mouse)
• Insert Size (bp): 1758
• GenBank ID: BC006704.1 NM_145508.2
• Entrez Gene: Dyrk3 (a.k.a. BC006704)
• Promoter: CMV with beta global intron
• Tags / Fusion Proteins:
  • 2A peptide (C terminal on insert)
  • mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SalI to XhoI (destroyed during cloning)
• 5′ sequencing primer: TGGTTGGGATAAGGCTGGAT
• 3′ sequencing primer: TTCAGCTTGGCGGTCTGGGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry