pAAV-CamkII-bPac(WT)-mCherry-minWPRE.sbd
(Plasmid #118278)

• Purpose: Expresses bPAC(WT)-mCherry under a minimal CamKII Promoter
• Depositing Lab: Dietmar Schmitz
• Publication: Bernal Sierra et al Nat Commun. 2018 Nov 5;9(1):4611. doi: 10.1038/s41467-018-07038-8.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: CW3SL
• Backbone manufacturer: Bong-Kiun Kaang
• Backbone size w/o insert (bp): 3771
• Total vector size (bp): 5591
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: bPAC(WT)
• Species: Beggiatoa sp.
• Insert Size (bp): 1055
• GenBank ID: GU461307.1
• Promoter: CamKII
• Tags / Fusion Proteins:
  • myc (C terminal on insert)
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTCTCCGTTTGCACTCAGGA
• 3′ sequencing primer: CGTATCCACATAGCGTAAAAGGAGCAA

Resource Information

• Supplemental Documents:
  • #436-pAAV-minCamkII bPac(WT)-mCherry-minWPRE.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry