pAAV-CamkII-bPac(WT)-mCherry-minWPRE.sbd
(Plasmid
#118278)
-
PurposeExpresses bPAC(WT)-mCherry under a minimal CamKII Promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCW3SL
-
Backbone manufacturerBong-Kiun Kaang
- Backbone size w/o insert (bp) 3771
- Total vector size (bp) 5591
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebPAC(WT)
-
SpeciesBeggiatoa sp.
-
Insert Size (bp)1055
-
GenBank IDGU461307.1
- Promoter CamKII
-
Tags
/ Fusion Proteins
- myc (C terminal on insert)
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTCTCCGTTTGCACTCAGGA
- 3′ sequencing primer CGTATCCACATAGCGTAAAAGGAGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CamkII-bPac(WT)-mCherry-minWPRE.sbd was a gift from Dietmar Schmitz (Addgene plasmid # 118278 ; http://n2t.net/addgene:118278 ; RRID:Addgene_118278) -
For your References section:
Potassium channel-based optogenetic silencing. Bernal Sierra YA, Rost BR, Pofahl M, Fernandes AM, Kopton RA, Moser S, Holtkamp D, Masala N, Beed P, Tukker JJ, Oldani S, Bonigk W, Kohl P, Baier H, Schneider-Warme F, Hegemann P, Beck H, Seifert R, Schmitz D. Nat Commun. 2018 Nov 5;9(1):4611. doi: 10.1038/s41467-018-07038-8. 10.1038/s41467-018-07038-8 PubMed 30397200