pN_35S/mCitrine/P_UBQ10/Derlin1-mOrange2
(Plasmid #118000)

• Purpose: Co-expression of mCitrine under the control of the CaMV 35S promoter and Derlin1 fused to mOrange2 (an ER-targeting marker protein) under the control of the A. thaliana ubiquitin-10 promoter.
• Depositing Lab: Mathias Pribil
• Publication: Behrendorff et al ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418.

Backbone

• Vector backbone: pN_35S/mCitrine (Addgene plasmid 117993)
• Backbone size w/o insert (bp): 2028
• Total vector size (bp): 12373
• Modifications to backbone: Added A. thaliana ubiquitin 10 promoter (P_UBQ10) and nosT terminator (nosT) to backbone. Insert resides between UBQ10 and nosT.
• Vector type: Plant Expression ; Plant/bacteria binary vector
• Selectable markers: Nourseothricin/streptothricin

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Derlin1-mOrange2
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 1521
• Promoter: Ubiquitin-10

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAGTTTCTAGTTTGTGCGATCG
• 3′ sequencing primer: TCATCGCAAGACCGGCAACA

Resource Information

• Supplemental Documents:
  • pN_35S_mCitrine_UBQ10_Derlin1-mOrange2.gb
• A portion of this plasmid was derived from a plasmid made by: The mOrange2 coding sequence was obtained from mOrange2-pBAD (a gift from Michael Davidson & Nathan Shaner & Roger Tsien, Addgene plasmid # 54531)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry