pN_35S/mCitrine/P_UBQ10/Derlin1-mOrange2
(Plasmid
#118000)
-
PurposeCo-expression of mCitrine under the control of the CaMV 35S promoter and Derlin1 fused to mOrange2 (an ER-targeting marker protein) under the control of the A. thaliana ubiquitin-10 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepN_35S/mCitrine (Addgene plasmid 117993)
- Backbone size w/o insert (bp) 2028
- Total vector size (bp) 12373
-
Modifications to backboneAdded A. thaliana ubiquitin 10 promoter (P_UBQ10) and nosT terminator (nosT) to backbone. Insert resides between UBQ10 and nosT.
-
Vector typePlant Expression ; Plant/bacteria binary vector
-
Selectable markersNourseothricin/streptothricin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDerlin1-mOrange2
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1521
- Promoter Ubiquitin-10
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGTTTCTAGTTTGTGCGATCG
- 3′ sequencing primer TCATCGCAAGACCGGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe mOrange2 coding sequence was obtained from mOrange2-pBAD (a gift from Michael Davidson & Nathan Shaner & Roger Tsien, Addgene plasmid # 54531)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN_35S/mCitrine/P_UBQ10/Derlin1-mOrange2 was a gift from Mathias Pribil (Addgene plasmid # 118000 ; http://n2t.net/addgene:118000 ; RRID:Addgene_118000) -
For your References section:
Membrane-bound protein scaffolding in diverse hosts using thylakoid protein CURT1A. Behrendorff JBYH, Sandoval-Ibanez OA, Sharma A, Pribil M. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418. 10.1021/acssynbio.8b00418 PubMed 30884945