pLJM1-Clover-Prx2-mRuby2
(Plasmid
#117907)
-
Purposefluorescent reporter of cytosolic hydrogen peroxide
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepLJM1
- Backbone size w/o insert (bp) 7330
- Total vector size (bp) 10057
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameClover-Prx2-mRuby2
-
Alt nameA pH-robust FRET sensor for hydrogen peroxide
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2727
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer aggtctatataagcaga
- 3′ sequencing primer ccccttttcttttaaaattg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-Clover-Prx2-mRuby2 was a gift from Hadley Sikes (Addgene plasmid # 117907 ; http://n2t.net/addgene:117907 ; RRID:Addgene_117907) -
For your References section:
Monitoring the action of redox-directed cancer therapeutics using a human peroxiredoxin-2-based probe. Langford TF, Huang BK, Lim JB, Moon SJ, Sikes HD. Nat Commun. 2018 Aug 7;9(1):3145. doi: 10.1038/s41467-018-05557-y. 10.1038/s41467-018-05557-y [pii] PubMed 30087344
