pJet1.2 sfGFP
(Plasmid #117123)

• Purpose: C-terminal GFP tag
• Depositing Lab: Stephan Gruber
• Publication: Diebold-Durand et al Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5.

Backbone

• Vector backbone: pJet1.2
• Backbone manufacturer: Thermo scientific
• Backbone size w/o insert (bp): 2974
• Total vector size (bp): 3745
• Vector type: Golden gate donor vector for gene targeting in Bacillus subtilis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Superfolder GFP
• Alt name: sfGFP
• Insert Size (bp): 750
• GenBank ID: CAA65278
• Tag / Fusion Protein:
  • sfGFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGACTCACTATAGGGAGAGCGGC
• 3′ sequencing primer: AAGAACATCGATTTTCCATGGCAG

Resource Information

• Supplemental Documents:
  • pJet 1.2 sfGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Donor vector that encodes for a C-terminal Superfolder GFP tag for Golden gate assembly reactions. Overhangs generated upon BsaI cleavage : AGCG (RtagN) and TAAG (RtagC).

(Gruber lab reference pSG710)