pSB1A3-AD009
(Plasmid #116850)

• Purpose: Expresses araC constitutively and alpha-hemolysin under a pBAD promoter; alternate name pSB1A2-AD009
• Depositing Lab: Friedrich Simmel
• Publication: Dupin et al Nat Chem. 2018 Nov 26. pii: 10.1038/s41557-018-0174-9. doi: 10.1038/s41557-018-0174-9.

Backbone

• Vector backbone: pSB1A2
• Backbone size w/o insert (bp): 2147
• Total vector size (bp): 4499
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: AraC
• Species: Escherichia coli
• Insert Size (bp): 984

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: VF tgccacctgacgtctaagaa
• 3′ sequencing primer: p-AD006_2_rev ggttatatctccttctagaggatccccg

Gene/Insert 2

• Gene/Insert name: alpha-HL
• Alt name: alpha-hemolysin
• Species: Staphylococcus aureus
• Insert Size (bp): 1304
• Promoter: pBAD

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: p-AD001_3_fwd AGACGAAAAACTACTAGATGG
• 3′ sequencing primer: VR attaccgcctttgagtgagc

Resource Information

• Supplemental Documents:
  • Annotated GenBank File
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that pSB1A2 was used to create the plasmid rather than pSB1A3. This does not affect function as described in the associated publication.