pcDNA3.3 ss-FLAG-AP-hNDP (aa 25-133)
(Plasmid
#115789)
-
PurposeExpresses and secretes human Norrin with N-terminal flag and alkaline phosphatase tags, contains artificial signal sequence upstream of tags.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.3 TOPO TA
- Backbone size w/o insert (bp) 5407
- Total vector size (bp) 7329
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNDP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1922
-
Entrez GeneNDP (a.k.a. EVR2, FEVR, ND)
- Promoter CMV
-
Tags
/ Fusion Proteins
- flag (N terminal on insert)
- alkaline phosphatase (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CTTCCGTGTTTCAGTTAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byImage clone 5179578
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.3 ss-FLAG-AP-hNDP (aa 25-133) was a gift from Harald Junge (Addgene plasmid # 115789 ; http://n2t.net/addgene:115789 ; RRID:Addgene_115789) -
For your References section:
TSPAN12 Is a Norrin Co-receptor that Amplifies Frizzled4 Ligand Selectivity and Signaling. Lai MB, Zhang C, Shi J, Johnson V, Khandan L, McVey J, Klymkowsky MW, Chen Z, Junge HJ. Cell Rep. 2017 Jun 27;19(13):2809-2822. doi: 10.1016/j.celrep.2017.06.004. 10.1016/j.celrep.2017.06.004 PubMed 28658627