pcDNA 3.3 ss-V5-hFZD4 (aa 37-537)
(Plasmid #115787)

• Purpose: Expresses human FZD4 with N-terminal V5-tag in mammalian cells, contains artificial signal sequence upstream of tag.
• Depositing Lab: Harald Junge
• Publication: Lai et al Cell Rep. 2017 Jun 27;19(13):2809-2822. doi: 10.1016/j.celrep.2017.06.004.

Backbone

• Vector backbone: pcDNA3.3 TOPO TA
• Backbone size w/o insert (bp): 5407
• Total vector size (bp): 7047
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FZD4
• Species: H. sapiens (human)
• Insert Size (bp): 1640
• Entrez Gene: FZD4 (a.k.a. CD344, EVR1, FEVR, FZD4S, Fz-4, Fz4, FzE4, GPCR, hFz4)
• Promoter: CMV
• Tag / Fusion Protein:
  • V5 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CTTCCGTGTTTCAGTTAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Image clone 5199771

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

N-terminal V5 tag has no substantial effect in TOPFlash reporter assays induced with Norrin, compared to untagged control. TOPFlash reporter assay can be inhibited by transfection of too much of this plasmid (see Lai et al., 2017 for detailed description of transfection conditions).