Skip to main content
Addgene

pcDNA 3.3 HA-hTSPAN12
(Plasmid #115784)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115784 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.3 TOPO TA
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5407
  • Total vector size (bp) 6377
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TSPAN12
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    970
  • Mutation
    multiple silent mutations introduce restriction sites to enable chimera construction
  • Entrez Gene
    TSPAN12 (a.k.a. EVR5, NET-2, NET2, TM4SF12)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTTCCGTGTTTCAGTTAGC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gene synthesis

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

N-terminal HA tag has no substantial effect in TOPFlash reporter assays induced with Norrin, compared to untagged control

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA 3.3 HA-hTSPAN12 was a gift from Harald Junge (Addgene plasmid # 115784 ; http://n2t.net/addgene:115784 ; RRID:Addgene_115784)

  • For your References section:

    TSPAN12 Is a Norrin Co-receptor that Amplifies Frizzled4 Ligand Selectivity and Signaling. Lai MB, Zhang C, Shi J, Johnson V, Khandan L, McVey J, Klymkowsky MW, Chen Z, Junge HJ. Cell Rep. 2017 Jun 27;19(13):2809-2822. doi: 10.1016/j.celrep.2017.06.004. 10.1016/j.celrep.2017.06.004 PubMed 28658627
Related items:
Commonly requested with: