Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mOtop2_pcDNA3
(Plasmid #114678)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114678 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5429
  • Total vector size (bp) 7121
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Otopetrin 2
  • Alt name
    Otop2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1692
  • GenBank ID
    NM_172801
  • Entrez Gene
    Otop2 (a.k.a. 4732464P15)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mOtop2_pcDNA3 was a gift from Emily Liman (Addgene plasmid # 114678 ; http://n2t.net/addgene:114678 ; RRID:Addgene_114678)
  • For your References section:

    An evolutionarily conserved gene family encodes proton-selective ion channels. Tu YH, Cooper AJ, Teng B, Chang RB, Artiga DJ, Turner HN, Mulhall EM, Ye W, Smith AD, Liman ER. Science. 2018 Mar 2;359(6379):1047-1050. doi: 10.1126/science.aao3264. Epub 2018 Jan 25. 10.1126/science.aao3264 PubMed 29371428