pAAV-EF1α-DIO-ReaChR-P2A-dTomato
(Plasmid #114368)

• Purpose: expresses a Cre-dependent red light-shifted channelrhodopsin variant
• Depositing Lab: Mingshan Xue
• Publication: Messier et al Elife. 2018 Aug 9;7. pii: 38506. doi: 10.7554/eLife.38506.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5324
• Total vector size (bp): 7148
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ReaChR-P2A-dTomato
• Alt name: red light shifted channelrhodopsin
• Insert Size (bp): 1824
• Promoter: EF1a
• Tag / Fusion Protein:
  • dTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI, BsrGI (unknown if destroyed)
• 3′ cloning site: NheI, BmtI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC (Ef1a-F)
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA (WPRE-R)

Resource Information

• Supplemental Documents:
  • #147 pAAV-EF1a-DIO-ReaChR-P2A-dTomato-WPRE-BGHpA.gbk
• A portion of this plasmid was derived from a plasmid made by: Backbone from pAAV-EF1α-DIO-oChIEF(E163A T199C)-P2A-dTomato (Addgene #51094); ReaChR insert from pAAV-hSyn-FLEX-ReaChR-Citrine (Addgene #50955)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/05/25/331165.1 for bioRxiv preprint.