pAAV-hSyn-NES-NIR-GECO1
(Plasmid #113683)

• Purpose: Express NIR-GECO1 preferentially in neurons
• Depositing Lab: Robert Campbell
• Publication: Qian et al Nat Methods. 2019 Feb;16(2):171-174. doi: 10.1038/s41592-018-0294-6. Epub 2019 Jan 21.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4557
• Total vector size (bp): 6111
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NES-NIR-GECO1
• Species: Synthetic
• Insert Size (bp): 1554
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GAGGAGTCGTGTCGTGCC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV NES-NIR-GECO1.gb
• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that discrepancies between sequencing results obtained by Addgene and the sequence provided by the depositor have been found. Sequences provided by depositing laboratories may be theoretical/predicted or based on Sanger/NGS sequencing results. The discrepancies found are not predicted to impact plasmid function.